GENOMA  HUMANO

Cromossoma 22 humano (início de sequência)

Human cromossoma 22 (sequence begining)

TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGGAGATCTTATG
AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTGTATTTTAGGT
TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTACCCTTCTCTC
TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGTGCACCCTTTG
GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGCTTGCTCTGAC
CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGCGTCCCCCTTT
CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAGCCTCAGAAAC
GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATTGGAAGGGACT
TCAGAAAGGAATTAGTTTACCTACTCATCAGGTGAGGAGACCCACAGAGGGGAAGTCACC

............................................................................................................

............................................................................................................

..................................................................................